Prev. |  KEGG KO K09485 > 

RIKEN DNA Bank Human Resource - HSPH1

Gene ID NCBI Gene 10808 |  KEGG hsa:10808
Gene Symbol HSPH1
Protein Name heat shock protein family H (Hsp110) member 1
Synonyms HSP105|HSP105A|HSP105B|NY-CO-25
Ortholog resources KEGG ortholog (KEGG orthology K09485) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04569 SEREX clone NGO-Br-38 #1 SEREX clone NGO-Br-38 #1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025652 IRAK064C04 pCMV-SPORT6 BC037553 NM_006644 Full
HGX009059 IRAK022K19 pCMV-SPORT6 BC018124 NM_006644 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR360953 RBd02G09 pGCAP10 NM_006644.2  
GGGTCGGTAGTTCAGCGCCGGCGCCGGTGTGCGAGCCGCGGCAGAGTGAGGCAGGCAACC
HKR382053 RBd55C05 pGCAP10 NM_006644.2  
GGTGGAGGGGCCGGTGGAGGCGCCGGTGAGTAAATGCCGCANNNTNNNGAAAGTTCTGAT
HKR382459 RBd56C11 pGCAP10 NM_006644.2  
GGTGGAGGGGCCGGTGGAGGCGCCGGTGAGTAAATGCCGCAGATTCTGGAAAGTTCTGAT
HKR393232 RBd83B08 pGCAP10 NM_006644.2  
TTGATCAGTGCGATACATAAGGCTGAGGAAGTGGGACCTCCCCTTTTGGGTCGGTAGTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl