Prev. |  KEGG KO K09228 > 

RIKEN DNA Bank Human Resource - ZNF268

Gene ID NCBI Gene 10795 |  KEGG hsa:10795
Gene Symbol ZNF268
Protein Name zinc finger protein 268
Synonyms HZF3
Ortholog resource in our bank

  ZNF268

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR181374 ARi53H06 pGCAP10 NM_003415.1  
GGGCCGCCATTGTTCCGCGCCGATGGCGAGATCCTTGTTCCTCAGATAGCGTTCATCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl