Prev. |  KEGG KO K09228 > 

RIKEN DNA Bank Human Resource - ZNF273

Gene ID NCBI Gene 10793 |  KEGG hsa:10793
Gene Symbol ZNF273
Protein Name zinc finger protein 273
Synonyms HZF9
Ortholog resource in our bank

  ZNF273

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056626 IRAK141J10 pCMV-SPORT6 BC063818 NM_021148 Full
HGY086474 IRAL016D02 pDNR-LIB BC008386 NM_021148 Partial
HGY088641 IRAL021K01 pDNR-LIB BC007078 NM_021148 Partial
HGY092708 IRAL031M20 pDNR-LIB BC019234 NM_021148 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR391610 RBd79A10 pGCAP10 NM_021148.2  
TGGACAGGACGGCTTCCGGGATTTGGCGGGGCCTTTGTCTCTCGCTGCAGTCGCAGCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl