Prev. | 

RIKEN DNA Bank Human Resource - ZNF271P

Gene ID NCBI Gene 10778 |  KEGG hsa:10778
Gene Symbol ZNF271P
Protein Name zinc finger protein 271, pseudogene
Synonyms CT-ZFP48|HZF7|ZNF-EB|ZNF-dp|ZNF271|ZNFEB
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010901 IRAK027E05 pCMV-SPORT6 BC017710 NM_006629 Full
HGY085630 IRAL014B06 pOTB7 BC004510 NM_006629 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR219824 ARiS049J08 pGCAP10 NR_024566.1  
TGGGAGCACTCCTCCCAGATTCCTAGAGCGGACAGGGCGATGGCAGGTTCGCCGGGTGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl