Prev. |  KEGG KO K12900 > 

RIKEN DNA Bank Human Resource - SRSF10

Gene ID NCBI Gene 10772 |  KEGG hsa:10772
Gene Symbol SRSF10
Protein Name serine and arginine rich splicing factor 10
Synonyms FUSIP1|FUSIP2|NSSR|PPP1R149|SFRS13|SFRS13A|SRp38|SRrp40|TASR|TASR1|TASR2
Ortholog resource in our bank

  SRSF10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067173 IRAK167P13 pBluescriptR BC071575 NM_054016
HGY083059 IRAL007K19 pOTB7 BC001107 NM_006625 Full
HGY087310 IRAL018E14 pOTB7 BC005039 NM_054016 Full
HGY091139 IRAL027O03 pOTB7 BC010074 NM_006625 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE010962 W01A027G18 pENTR-TOPO IRAL027O03 BC010074 NM_006625  
HGE010966 W01A027G22 pENTR-TOPO IRAL027O03 BC010074 NM_006625  
HGE010968 W01A027G24 pENTR-TOPO IRAL027O03 BC010074 NM_006625  
HGE038441 W01A096B17 pENTR-TOPO IRAL007K19 BC001107 NM_006625  
HGE038479 W01A096D07 pENTR-TOPO IRAL007K19 BC001107 NM_006625  
HGE047911 W01A119M23 pENTR-TOPO IRAL007K19 BC001107 NM_006625  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR238587 ARiS096H19 pGCAP10 NM_006625.3  
GAGCAGAGCCCTCTAGCTGTGTGTGTCTGAGGCTCGGCCGCCTGAGCCGCGGACGGTTTG
HKR372851 RBd32C03 pGCAP10 NM_006625.3  
GAGTGCGCCCGGCCGAGACACGCCGCCGCCATGTCCCGCTACCTGCGTCCCCCCAACACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl