Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AHCYL1

Gene ID (NCBI) 10768
Gene Symbol AHCYL1
Protein Name adenosylhomocysteinase-like 1
Synonyms DCAL|IRBIT|PRO0233|XPVKONA
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K01251)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005245 IRAK013B21 pCMV-SPORT6 BC010681 NM_006621 Full
HGX008015 IRAK020A15 pCMV-SPORT6 BC016942 NM_006621 Full
HGX056181 IRAK140H13 pCMV-SPORT6 BC065254 NM_006621 Full
HGY081230 IRAL003B06 pOTB7 BC003631 NM_006621 Partial
HGY088989 IRAL022H21 pOTB7 BC007576 NM_006621 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR183369 ARi58H01 pGCAP10 NM_006621.4  
GAGGTGGCGGCGCGGGCAGGTCGGAGCTCGGAGCTGCTGCTTCTGGTTCTCTTGTGGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl