Prev. |  KEGG KO K01251 > 

RIKEN DNA Bank Human Resource - AHCYL1

Gene ID NCBI Gene 10768 |  KEGG hsa:10768
Gene Symbol AHCYL1
Protein Name adenosylhomocysteinase like 1
Synonyms DCAL|IRBIT|PPP1R78|PRO0233|XPVKONA
Ortholog resources KEGG ortholog (KEGG orthology K01251) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005245 IRAK013B21 pCMV-SPORT6 BC010681 NM_006621 Full
HGX008015 IRAK020A15 pCMV-SPORT6 BC016942 NM_006621 Full
HGX056181 IRAK140H13 pCMV-SPORT6 BC065254 NM_006621 Full
HGY081230 IRAL003B06 pOTB7 BC003631 NM_006621 Partial
HGY088989 IRAL022H21 pOTB7 BC007576 NM_006621 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR183369 ARi58H01 pGCAP10 NM_006621.4  
GAGGTGGCGGCGCGGGCAGGTCGGAGCTCGGAGCTGCTGCTTCTGGTTCTCTTGTGGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl