Prev. |  KEGG KO K20056 > 

RIKEN DNA Bank Human Resource - GIPC1

Gene ID NCBI Gene 10755 |  KEGG hsa:10755
Gene Symbol GIPC1
Protein Name GIPC PDZ domain containing family member 1
Synonyms C19orf3|GIPC|GLUT1CBP|Hs.6454|IIP-1|NIP|RGS19IP1|SEMCAP|SYNECTIIN|SYNECTIN|TIP-2
Ortholog resources KEGG ortholog (KEGG orthology K20056) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04554 SEREX clone NGO-Br-55 (ID 1291, 1292) #1 SEREX clone NGO-Br-55 (ID 1291, 1292) #1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080662 IRAL001K22 pOTB7 BC000410 NM_202494 Full
HGY084117 IRAL010E21 pOTB7 BC012810 NM_202494 Full
HGY084704 IRAL011M16 pOTB7 BC004226 NM_202494 Full
HGY089384 IRAL023H16 pOTB7 BC016169 NM_202494 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR073375 ARe83H07 pKA1U5 NM_202468.1  
GGAGCCGGGTGCGCACGGGGAGGCGGAGGCAGCGGCGGCGGCGGCGGCGGCGGCGGCGGC
HKR169328 ARi23F08 pGCAP10 NM_202468.1  
GGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGCAGATGAAGAAACTGAGGCCCTGTG
HKR171235 ARi28B11 pGCAP10 NM_202468.1  
GGGAGGGCCGAGCCGGGTGCGCACGGGGAGGCGGAGGCAGCGGCGGCGGCGGCGGCGGCG
HKR183378 ARi58H10 pGCAP10 NM_202468.1  
GAGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGCAGATGAAGAAACTGAGGCCCTGTG
HKR209287 ARiS023D15 pGCAP10 NM_202468.1  
GGAGCCGGGTGCGCACGGGGAGGCGGAGGCAGCGGCGGCGGCGGCGGCGGCGGCGGCGGC
HKR219664 ARiS049C16 pGCAP10 NM_202468.1  
GAGGCAGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGCAGGACCATTCTGGCTGCTGT
HKR249021 ARiS122J05 pGCAP10 NM_202468.1  
GGCGGAGGGCCGAGCCGGGTGCGCACGGGGAGGCGGAGGCAGCGGCGGCGGCGGCGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl