Prev. |  KEGG KO K08955 > 

RIKEN DNA Bank Human Resource - YME1L1

Gene ID NCBI Gene 10730 |  KEGG hsa:10730
Gene Symbol YME1L1
Protein Name YME1 like 1 ATPase
Synonyms FTSH|MEG4|OPA11|PAMP|YME1L
Ortholog resources KEGG ortholog (KEGG orthology K08955) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084315 IRAL010N03 pOTB7 BC024032 NM_014263 Full
HGY084842 IRAL012B18 pOTB7 BC023507 NM_014263 Full
HGY088059 IRAL020C11 pOTB7 BC007795 NM_139313 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR058084 ARe45D12 pKA1U5 NM_014263.2  
GGGGGCGGATTGTCTGTCGTTGCAGTAGCTGTAGGAAGGGGAGGCCATTTTCCGTTTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl