Prev. |  KEGG KO K15730 > 

RIKEN DNA Bank Human Resource - PTGES3

Gene ID NCBI Gene 10728 |  KEGG hsa:10728
Gene Symbol PTGES3
Protein Name prostaglandin E synthase 3
Synonyms P23|TEBP|cPGES
Ortholog resources KEGG ortholog (KEGG orthology K15730) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083685 IRAL009D13 pOTB7 BC003005 NM_006601
HGY092443 IRAL031B19 pDNR-LIB BC021167 NM_006601 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR058907 ARe47E11 pKA1U5 NM_006601.5  
GGAGGTCGAGCCCGCCGCTGCCGCCGTCGCCTGAGGGAAGCGAGAAGAGGCCGCGACCGG
HKR059210 ARe48A10 pKA1U5 NM_006601.5  
GATTCTCCGTCCTCGCGCCCCTTTTCCTACACTTTCCTCTTCTCCCCGACCGGAGGAGCC
HKR059250 ARe48C02 pKA1U5 NM_006601.5  
GATTCTGGGGCCCGAGGTCGAGCCCGCCGCTGCCGCCGNTCGCCTGAGGGAAGCGAGAAG
HKR062948 ARe57G04 pKA1U5 NM_006601.5  
TGGCTGCCGCCGTCGCCTGAGGGAAGCGAGAAGAGGCCGCGACCGGAGAGAAAAAGCGGA
HKR062973 ARe57H05 pKA1U5 NM_006601.5  
GCTCACAACCCCTCGATTTGCACGCACGTCACGNTCCNTTTTANGTCCTCGCGCCCCATT
HKR066480 ARe66D08 pKA1U5 NM_006601.5  
TTGGTTCATTCTCCGTCCTCGCGCCCCTTTTCCTACACTTTCCTCTTCTCCCCGACCGGA
HKR072060 ARe80C12 pKA1U5 NM_006601.5  
GATTCTGGGGCCCGAGGTCGAGCCCGCCGCTGCCGCCGNTCGCCTGAGGGAAGCGAGAAG
HKR077630 ARe94B06 pKA1U5 NM_006601.5  
GGTAGATATCTCTAGAAAGCCGCGCCGGAGCCCAAAAACAAGGACTGCGCACGCGCGGCG
HKR078954 ARe97G10 pKA1U5 NM_006601.5  
GGAGGTCGAGCCCGCCGCTGCCGCCGTCGCCTGAGGGAAGCGAGAAGAGGCCGCGACCGG
HKR172506 ARi31E10 pGCAP10 NM_006601.5  
GCTCACCACCCCTCGTTTGCACGCACGCACGTTCATTCTCCGTCCTCGCGCCCCTTTTCC
HKR177307 ARi43E11 pGCAP10 NM_006601.5  
GCTCACCACCCCTCGTTTGCACGCACGCACGTTCATTCTCCGTCCTCGCGCCCCTTTTCC
HKR186852 ARi67C04 pGCAP10 NM_006601.5  
GCTCTTCTCCCCGACCGGAGGAGCCGCTCTTTCCGCGCGGTGCATTCTGGGGCCCGAGGT
HKR205366 ARiS013G22 pGCAP10 NM_006601.5  
GGTCCTCGCGCCCCTTTTCCTACACTTTCCTCTTCTCCCCGACCGGAGGAGCCGCTCTTT
HKR235373 ARiS088H05 pGCAP10 NM_006601.5  
GGCTGCCGCCGTCGCCTGAGGGAAGCGAGAAGAGGCCGCGACCGGAGAGAAAAAGCGGAG
HKR264430 ARiS161B06 pGCAP10 NM_006601.5  
TTTGCTCACCACCCCTCGTTTGCACGCACGCACGTTCATTCTCCGTCCTCGCGCCCCTTT
HKR330808 RBb27A08 pGCAP1 NM_006601.5  
GATTCTGGGGCCCGAGGTCGAGCCCGCCGCTGCCGCCGTCGCCTGAGGGAAGCGAGAAGA
HKR345283 RBb63D11 pGCAP1 NM_006601.5  
GCTCACCACCCTTCGTTTGCACGCACGCACGTTCATTCTCCGTCCTCGCGCCCCTTTTCC
HKR379722 RBd49F02 pGCAP10 NM_006601.5  
GACACTTTCCTCTTCTCCCCGACCGGAGGAGCCGCTCTTTCCGCGCGGTGCATTCTGGGG
HKR392549 RBd81G05 pGCAP10 NM_006601.5  
TGAGGTCGAGCCCGCCGCTGCCGCCGTCGCCTGAGGGAAGCGAGAAGAGGCCGCGACCGG
HKR406037 RBdS015B13 pGCAP10 NM_006601.5  
GATTCTCCGTCCTCGCGCCCCTTTTCCTACACTTTCCTCTTCTCCCCGACCGGAGGAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl