Prev. |  KEGG KO K13627 > 

RIKEN DNA Bank Human Resource - SLC12A7

Gene ID NCBI Gene 10723 |  KEGG hsa:10723
Gene Symbol SLC12A7
Protein Name solute carrier family 12 member 7
Synonyms KCC4
Ortholog resource in our bank

  SLC12A7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR277660 ARiS194C12 pGCAP10 NM_006598.2  
GGGGAGNGNNGCAGCGCGGGCCGGGCCGGGACGGGGACTGTCGGCTGCAGGCGGCCATGC
HKR344855 RBb62C07 pGCAP1 NM_006598.2  
GCCAAGTCCCGTGGCGTCGGCGGGAGCGGCGCAGCGCGGGCCGNTTCGGGACGGGGTACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl