Prev. |  KEGG KO K12847 > 

RIKEN DNA Bank Human Resource - USP39

Gene ID NCBI Gene 10713 |  KEGG hsa:10713
Gene Symbol USP39
Protein Name ubiquitin specific peptidase 39
Synonyms 65K|CGI-21|HSPC332|SAD1|SNRNP65
Ortholog resource in our bank

  USP39

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056623 IRAK141J07 pCMV-SPORT6 BC067273 NM_006590 Full
HGY081847 IRAL004K07 pOTB7 BC001384 NM_006590 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE042190 W01A105H22 pENTR-TOPO IRAK141J07 BC067273 NM_006590  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR363612 RBd09A12 pGCAP10 NM_006590.2  
GACGACTCGGCCGGTAGTGGAGATGTCCGGCCGGTCTAAGCGGGAGTCTCGCGGTTCCAC
HKR368460 RBd21C12 pGCAP10 NM_006590.2  
GGTGCTTGTCGCCTGCGCTGGACNACTCGGCCGGNNGTGGAGATGTCCGGCCGGTCTGGG
HKR370127 RBd25F07 pGCAP10 NM_006590.2  
GGCTTGGCGCCTGCGCTGGACGACTCGGCCGGTAGTGGAGATGTCCGGCCGGTCTAAGCG
HKR371774 RBd29H06 pGCAP10 NM_006590.2  
GGGTAGTGGAGATGTCCGGCCGGTCTAAGCGGGAGTCTCGCGGTTCCACTCGCGGGAAGC
HKR398402 RBd96A02 pGCAP10 NM_006590.2  
GAGTGGAGATGTCCGGCCGGTCTAAGCGGGAGTCTCGCGGTTCCACTCGCGGGAAGCGAG
HKR398576 RBd96H08 pGCAP10 NM_006590.2  
GGACTCGGCCGGTAGTGGAGATGTCCGGCCGGTCTAAGCGGGAGTCTCGCGGTTCCACTC
HKR420582 RBdS051H14 pGCAP10 NM_006590.2  
GGGTAGTGGAGATGTCCGGCCGGTCTAAGCGGGAGTCTCGCGGTTCCACTCGCGGGAAGC
HKR432679 RBdS081L15 pGCAP10 NM_006590.2  
GGACTCGGCCGGTAGTGGAGATGTCCGGCCGGTCTAAGCGGGAGTCTCGCGGTTCCACTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl