Prev. | 

RIKEN DNA Bank Human Resource - CNPY3

Gene ID NCBI Gene 10695 |  KEGG hsa:10695
Gene Symbol CNPY3
Protein Name canopy FGF signaling regulator 3
Synonyms CAG4A|ERDA5|PRAT4A|TNRC5
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX007921 IRAK019N09 pCMV-SPORT6 BC008133 NM_183010 Full
HGY081100 IRAL002M12 pOTB7 BC008898 NM_006586 Full
HGY083943 IRAL009O07 pOTB7 BC004423 NM_183010 Partial
HGY084291 IRAL010M03 pOTB7 BC008961 NM_006586 Full
HGY084591 IRAL011H23 pOTB7 BC022093 NM_006586 Partial
HGY090940 IRAL027F20 pOTB7 BC011767 NM_183010 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097646 M01C044B22 pDONR221 MGC11-H11 BC008898 ENST00000336842  
HGE097694 M01C044D22 pDONR221 MGC11-H11 BC008898 ENST00000336842  
HGE097742 M01C044F22 pDONR221 MGC11-H11 BC008898 ENST00000336842  
HGE097790 M01C044H22 pDONR221 MGC11-H11 BC008898 ENST00000336842  
HGE097838 M01C044J22 pDONR221 MGC11-H11 BC008898 ENST00000336842  
HGE097886 M01C044L22 pDONR221 MGC11-H11 BC008898 ENST00000336842  
HGE097934 M01C044N22 pDONR221 MGC11-H11 BC008898 ENST00000336842  
HGE097982 M01C044P22 pDONR221 MGC11-H11 BC008898 ENST00000336842  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR164521 ARi11F01 pGCAP10 NM_006586.3  
GGAGGGGAAACTGCTCCGCGCGCGCCGCGGGAGGAGGAACCGCCCGGTCCTTTAGGGTCC
HKR249125 ARiS122N13 pGCAP10 NM_006586.3  
GGGGGAAACTGCTCCGCGCGCGCCGCGGGAGGAGGAACCGCCCGGTCCTTTAGGGTCCGG
HKR279355 ARiS198G11 pGCAP10 NM_006586.3  
GAACTGCTCCGCGCGCGCCGCGGGAGGAGGAACCGCCCGGTCCTTTAGGGTCCGGGCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl