Prev. |  KEGG KO K09500 > 

RIKEN DNA Bank Human Resource - CCT8

Gene ID NCBI Gene 10694 |  KEGG hsa:10694
Gene Symbol CCT8
Protein Name chaperonin containing TCP1 subunit 8
Synonyms C21orf112|Cctq|D21S246|PRED71
Ortholog resources KEGG ortholog (KEGG orthology K09500) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087753 IRAL019G09 pDNR-LIB BC012584 NM_006585 Full/var
HGY103483 IRAL058L19 pOTB7 BC072001 NM_006585 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR222135 ARiS055F15 pGCAP10 NM_006585.2  
GCCTCGCTTTCTCCGCGGTCTTCCGAGCGGTCGCGTGAACTGCTTCCTGCAGGCTGGCCA
HKR247223 ARiS118A23 pGCAP10 NM_006585.2  
GCTCCTCGCTTCCTCCGCGGTCTTTCGAGCGGTCGCGTGAACTGCTTCCTGCAGGCTGGC
HKR247267 ARiS118C19 pGCAP10 NM_006585.2  
GGCTTCCTCCNCGGTCTTTCGAGCGGTCGCGTGAACTGCTTCCTGCAGGCTGGCCATGGC
HKR260346 ARiS150O10 pGCAP10 NM_006585.2  
GGCTTTCTCCGCGGTCTTCCGAGCGGTCGCGTGAACTGCTTCCTGCAGGCTGGCCATGGC
HKR322900 RBb07E04 pKA1U5 NM_006585.2  
GGCTGCTTTCCCAGAAGGCTGTGCGTGCTCCTCGCTTCCTCCGCGGTCTTCCGAGCGGTC
HKR330551 RBb26G07 pGCAP1 NM_006585.2  
GCTCCGCGGTCTTCCGAGCGGTCGCGTGAACTGCTTCCTGCAGGCTGGCCATGGCGCTTC
HKR345605 RBb64A05 pGCAP1 NM_006585.2  
GTCTCCGCGGTCTTCCGAGCGGTCGCGTGAACTGCTTCCTGCAGGCTGGCCATGGCGCTT
HKR362457 RBd06C09 pGCAP10 NM_006585.2  
TTGAGGCTGTGCGTGCTCCTCGCTTTCTCCGCGGTCTTCCGAGCGGTCGCGTGAACTGCT
HKR364030 RBd10B06 pGCAP10 NM_006585.2  
GGCTTTCTCCGCGGTCTTCCGAGCGGTCGCGTGAACTGCTTCCTGCAGGCTGGCCATGGC
HKR367603 RBd19A03 pGCAP10 NM_006585.2  
GACGCTGCTTTCCCAGAAGGCTGTGCGTGCTCCTCGCTTCCTCCGCGGTCTTCCGAGCGG
HKR370102 RBd25E06 pGCAP10 NM_006585.2  
GGCTTTCCCAGAAGGCTGTGCGTGCTCCTCGCTTCCTCCGCGGTCTTCCGAGCGGTCGCG
HKR372427 RBd31B03 pGCAP10 NM_006585.2  
GGGCCCCACGCTGCTTTCCCAGAAGGCTGTGCGTGCTCCTCGCTTTCTCCGCGGTCTTCC
HKR373675 RBd34D03 pGCAP10 NM_006585.2  
GGCTTTCTCCGCGGTCTTCCGAGCGGTCGCGTGAACTGCTTCCTGCAGGCTGGCCATGGC
HKR382572 RBd56H04 pGCAP10 NM_006585.2  
GGAGCGGTCGCGTGAACTGCTTCCTGCAGGCTGGCCATGGNNNTTNACGTTCCCAAGGCT
HKR420720 RBdS051N08 pGCAP10 NM_006585.2  
GGGCTGTGCGTGCTCCTCGCTTTCTCCGCGGTCTTCCGAGCGGTCGCGTGAACTGCTTCC
HKR428328 RBdS070N16 pGCAP10 NM_006585.2  
AGGGTGAACTGCTTCCTGCAGGCTGGCCATGGCGCTTCACGTTCCCAAGGCTCCGGGCTT
HKR442298 RBdS105M10 pGCAP10 NM_006585.2  
GTCCTCGCTTCCTCCGCGGTCTTCCGAGCGGTCGCGTGAACTGCTTCCTGCAGGCTGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl