Prev. |  KEGG KO K06051 > 

RIKEN DNA Bank Human Resource - DLL3

Gene ID NCBI Gene 10683 |  KEGG hsa:10683
Gene Symbol DLL3
Protein Name delta like canonical Notch ligand 3
Synonyms SCDO1
Featured content Notch signaling pathway (human)
Ortholog resource in our bank

  DLL3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083018 IRAL007J02 pOTB7 BC000218 NM_016941 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR336008 RBb40A08 pGCAP1 NM_016941.3  
GTCCCGAGACCCCCCCACCAGAAAGGCCATGGTCTCCCCACGGATGTCCGGGCTCCTCTC
HKR336402 RBb41A02 pGCAP1 NM_016941.3  
GTCCCGAGACCCCCCCACCAGAAGGCCATGGTCTCCCCACGGTATGTCCGGGCTCCTCTC
HKR388503 RBd71E07 pGCAP10 NM_016941.3  
GTCCCGAGACCCCCCCACCAGAAGGCCATGGTCTCCCCACGGATGTCCGGGCTCCTCTCC
HKR432503 RBdS081E07 pGCAP10 NM_016941.3  
GACTCCCGAGACCCCCCCACCAGAAGGCCATGGTCTCCCCACGGATGTCCGGGCTCCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl