Prev. | Human A to Z list > D > 

RIKEN DNA Bank Human Resource - DLL3

Gene ID (NCBI) 10683
Gene Symbol DLL3
Protein Name delta-like 3 (Drosophila)
Synonyms SCDO1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Notch signaling pathway (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083018 IRAL007J02 pOTB7 BC000218 NM_016941 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR336008 RBb40A08 pGCAP1 NM_016941.3
GTCCCGAGACCCCCCCACCAGAAAGGCCATGGTCTCCCCACGGATGTCCGGGCTCCTCTC
HKR336402 RBb41A02 pGCAP1 NM_016941.3
GTCCCGAGACCCCCCCACCAGAAGGCCATGGTCTCCCCACGGTATGTCCGGGCTCCTCTC
HKR388503 RBd71E07 pGCAP10 NM_016941.3
GTCCCGAGACCCCCCCACCAGAAGGCCATGGTCTCCCCACGGATGTCCGGGCTCCTCTCC
HKR432503 RBdS081E07 pGCAP10 NM_016941.3
GACTCCCGAGACCCCCCCACCAGAAGGCCATGGTCTCCCCACGGATGTCCGGGCTCCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl