Prev. |  KEGG KO K06051 > 

RIKEN DNA Bank Human Resource - DLL3

Gene ID NCBI Gene 10683 |  KEGG hsa:10683
Gene Symbol DLL3
Protein Name delta like canonical Notch ligand 3
Synonyms SCDO1
Ortholog resources KEGG ortholog (KEGG orthology K06051) in the DNA Bank
Featured content Notch signaling pathway (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083018 IRAL007J02 pOTB7 BC000218 NM_016941 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR336008 RBb40A08 pGCAP1 NM_016941.3  
GTCCCGAGACCCCCCCACCAGAAAGGCCATGGTCTCCCCACGGATGTCCGGGCTCCTCTC
HKR336402 RBb41A02 pGCAP1 NM_016941.3  
GTCCCGAGACCCCCCCACCAGAAGGCCATGGTCTCCCCACGGTATGTCCGGGCTCCTCTC
HKR388503 RBd71E07 pGCAP10 NM_016941.3  
GTCCCGAGACCCCCCCACCAGAAGGCCATGGTCTCCCCACGGATGTCCGGGCTCCTCTCC
HKR432503 RBdS081E07 pGCAP10 NM_016941.3  
GACTCCCGAGACCCCCCCACCAGAAGGCCATGGTCTCCCCACGGATGTCCGGGCTCCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl