Prev. |  KEGG KO K01889 > 

RIKEN DNA Bank Human Resource - FARS2

Gene ID NCBI Gene 10667 |  KEGG hsa:10667
Gene Symbol FARS2
Protein Name phenylalanyl-tRNA synthetase 2, mitochondrial
Synonyms COXPD14|FARS1|HSPC320|PheRS|SPG77
Ortholog resources KEGG ortholog (KEGG orthology K01889) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY096363 IRAL040P03 pOTB7 BC020239 NM_006567 Full
HGY096374 IRAL040P14 pOTB7 BC021112 NM_006567 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR428259 RBdS070K19 pGCAP10 NM_006567.3  
GCCGGAGGCTCGGGACCCAGCAGCCGCTCCACGCGGCGGGAGGGCAGGGAAATAAGAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl