Prev. |  KEGG KO K23195 > 

RIKEN DNA Bank Human Resource - CTCF

Gene ID NCBI Gene 10664 |  KEGG hsa:10664
Gene Symbol CTCF
Protein Name CCCTC-binding factor
Synonyms MRD21
Ortholog resources KEGG ortholog (KEGG orthology K23195) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB18353 CTCF-mAC donor (Neo) Donor plasmid to generate CTCF-mAID degron cell lines with mClover as a marker, neomycin resistance.
RDB18354 CTCF-mAC donor (Hygro) Donor plasmid to generate CTCF-mAID degron cell lines with mClover as a marker, hygromycin resistance.
RDB18355 CTCF-C CRISPR Expression vector of Cas9 and gRNA for a CTCF tagging donor.

webcatalog20210331.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085896 IRAL014M08 pOTB7 BC014267 NM_006565 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2021Apr07.csv
GNP_full_IRAL_2021Apr13.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE018193 W01A045I01 pENTR-TOPO IRAL014M08 BC014267 NM_006565  

♦ W series clone contains a stop codon.

GNP_entry_W01A_210404.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR219894 ARiS049M06 pGCAP10 NM_006565.2  
GGTGCGCGGAGCTGCTTCTTTGGCGGCAGCGGCGGCGGCGGTGGCCGGTGCGGACGCGCG
HKR376802 RBd42A02 pGCAP10 NM_006565.2  
GGAGCGATTAAACCGTGCGCGGAGCTGCTTCTTTGGCGGCAGCGGCGGCGGCGGTGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2022.02.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl