Prev. |  KEGG KO K13198 > 

RIKEN DNA Bank Human Resource - KHDRBS1

Gene ID NCBI Gene 10657 |  KEGG hsa:10657
Gene Symbol KHDRBS1
Protein Name KH RNA binding domain containing, signal transduction associated 1
Synonyms Sam68|p62|p68
Ortholog resource in our bank

  KHDRBS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082925 IRAL007F05 pOTB7 BC000717 NM_006559 Full
HGY091060 IRAL027K20 pOTB7 BC010132 NM_006559 Full/var
HGY095972 IRAL039P12 pOTB7 BC019109 NM_006559 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE011437 W01A028J21 pENTR-TOPO IRAL007F05 BC000717 NM_006559  
HGE011439 W01A028J23 pENTR-TOPO IRAL007F05 BC000717 NM_006559  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048906 ARe22E10 pKA1U5 NM_006559.1  
GCTCGCTGGGTCGCTCGGGTCGGCTTCGGTCGCATACCGCATCCCGCTCTGCCACCCCCG
HKR068573 ARe71H05 pKA1U5 NM_006559.1  
GCTCGCTGGGTCGCTCGGGTCGGCTTCGGTCGCTANCGCTCCCGCTCTGCCACCCCCGCC
HKR069281 ARe73D09 pKA1U5 NM_006559.1  
GGCTCGCTGGGTCGCTCGGGTCGGCTTCGGTCCCTANNGCTCCCGCTCTGCCACCCCCGCC
HKR238534 ARiS096F14 pGCAP10 NM_006559.1  
GGGCTTCGGTCGCTACCGCTCCCGCTCTGCCACCCCCGCCAACCGCCGCTCGGGCCTCCG
HKR238661 ARiS096K21 pGCAP10 NM_006559.1  
GGGCTTCGGTCGCTACCGCTCCCGCTCTGCCACCCCCGCCAACCGCCGCTCGGGCCTCCG
HKR238767 ARiS096P07 pGCAP10 NM_006559.1  
TGGCTGGGTCGCTCGGGTCGGCTTCGGTCGCTACCGCTCCCGCTCTGCCACCCCCGCCAA
HKR348456 RBb71C08 pGCAP1 NM_006559.1  
GCCTCATTTCCGGTGCTCTCTCTCGCTGGGTCGCTCGGGTCGGCTTCGGTCGCTACCGCT
HKR361254 RBd03C06 pGCAP10 NM_006559.1  
GCTCTCGCTGGGTCGCTCGGGTCGGCTTCGGTCGCTACCGCTCCCGCTCTGCCACCCCCG
HKR370404 RBd26A04 pGCAP10 NM_006559.1  
GCTCTCGCTGGGTCGCTCGGGTCGGCTTCGGTCGCTACCGCTCCCGCTCTGCCACCCCCG
HKR398030 RBd95B06 pGCAP10 NM_006559.1  
GCTCGCTGGGTCGCTCGGGTCGGCTTCGGTCGCTACCGCTCCCGCTCTGCCACCCCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl