Prev. | 

RIKEN DNA Bank Human Resource - SPINT2

Gene ID NCBI Gene 10653 |  KEGG hsa:10653
Gene Symbol SPINT2
Protein Name serine peptidase inhibitor, Kunitz type 2
Synonyms DIAR3|HAI-2|HAI2|Kop|PB
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008414 IRAK021A14 pCMV-SPORT6 BC011951 NM_021102 Full/var
HGX008422 IRAK021A22 pCMV-SPORT6 BC011955 NM_021102 Full/var
HGX008447 IRAK021B23 pCMV-SPORT6 BC012868 NM_021102 Full/var
HGY081006 IRAL002I14 pOTB7 BC001668 NM_021102 Full
HGY086333 IRAL015N21 pOTB7 BC007705 NM_021102 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE005181 W01A012P21 pENTR-TOPO IRAL002I14 BC001668 NM_021102  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042835 ARe07B11 pKA1U5 NM_021102.2  
TGGCCGTTGAGTGTCGCAGGCGGCGAGGGCGCGAGTGAGGAGCAGACCCAGGCATCGCGC
HKR054177 ARe35H09 pKA1U5 NM_021102.2  
GATTGGCTCTGGCGACCTCCGCGCGTTGGGAGGTGTAGCGCGGCTCTGAACGCGCTGAGG
HKR082028 ARf05B04 pKA1U5 NM_021102.2  
GCTGCCCGGCCACCTTCGGGAGCCGCTTCCAATAGGCGTTCGCCATTGGCTCTGGCGACC
HKR179610 ARi49A10 pGCAP10 NM_021102.2  
GGGGCCGTTGAGTGTCCCAGGCTCCGNAGGCGCGAGTGAGGAGCAGACCCCTCCATCACG
HKR209455 ARiS023K15 pGCAP10 NM_021102.2  
GGGCGTCGCCTGCGCGTCTCGGCTGAGCTGGCCATGGCGCAGCTGTGCGGGCTGAGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl