Prev. | 

RIKEN DNA Bank Human Resource - PRELID3A

Gene ID NCBI Gene 10650 |  KEGG hsa:10650
Gene Symbol PRELID3A
Protein Name PRELI domain containing 3A
Synonyms C18orf43|HFL-EDDG1|SLMO1
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR375611 RBd39A11 pGCAP10 NM_006553.2  
GGGGCGTGGATGTGCTACAGCGCCGCGTGGACGGCCGCGGCCGCCTGCACAGCTTGCGCC
HKR383727 RBd59F07 pGCAP10 NM_006553.2  
GGGCAATGAAGATCTGGAGCTCGGAGCACGTGTTTGGGTGAGGCCGGGCTGAGGGCCGCG
HKR406003 RBdS015A03 pGCAP10 NM_006553.2  
GCCCCGAAGCACCCGGCCCGGATCGCAGAGCCCGCGCCCTGCGCCGGCGGCAATGAAGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl