Prev. |  KEGG KO K15046 > 

RIKEN DNA Bank Human Resource - IVNS1ABP

Gene ID NCBI Gene 10625 |  KEGG hsa:10625
Gene Symbol IVNS1ABP
Protein Name influenza virus NS1A binding protein
Synonyms ARA3|FLARA3|HSPC068|IMD70|KLHL39|ND1|NS-1|NS1-BP|NS1BP
Ortholog resource in our bank

  IVNS1ABP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04584 SEREX clone NGO-Br-61 (ID 1300) #1 SEREX clone NGO-Br-61 (ID 1300) #1

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067342 IRAK168F22 pBluescriptR BC067739 NM_006469 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE019226 W01A048B02 pENTR-TOPO flj0034k14 AK023020 NM_016389  
HGE019232 W01A048B08 pENTR-TOPO flj0034k14 AK023020 NM_016389  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235445 ARiS088K05 pGCAP10 NM_006469.4  
GAGTGTCTCCCGGTCGCGCGTGGAGGTCGGTCGCTCAGAGCTGCTGGGCGCAGTTTCTCC
HKR444154 RBdS110G10 pGCAP10 NM_006469.4  
GGTGGTGACGTGCGAGGGGGTGCGGCGCGAGCGGTCGGCGGCGGCGGAGGCAGTGTCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl