Prev. |  KEGG KO K10630 > 

RIKEN DNA Bank Human Resource - RBCK1

Gene ID NCBI Gene 10616 |  KEGG hsa:10616
Gene Symbol RBCK1
Protein Name RANBP2-type and C3HC4-type zinc finger containing 1
Synonyms C20orf18|HOIL-1|HOIL1|PBMEI|PGBM1|RBCK2|RNF54|UBCE7IP3|XAP3|XAP4|ZRANB4
Ortholog resources KEGG ortholog (KEGG orthology K10630) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04183 BS-KS HOIL-1 Plasmid clone of human heme-oxidized IRP2 ubiquitin ligase (HOIL-1) cDNA

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005637 IRAK014B13 pCMV-SPORT6 BC015219 NM_031229 Full
HGY089698 IRAL024E02 pOTB7 BC016301 NM_006462 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR055683 ARe39D11 pKA1U5 NM_031229.2  
GGGGGCCTCCCGGGAGGAGAGAGGGCTTTGCCTTGAAACCCGGGACGCCAGGGGCGCTCC
HKR056976 ARe42H08 pKA1U5 NM_031229.2  
GGGGAGTCCGGGGACCCGCGATCAGCCCCGGAGGACGGGGTGGGGTCGCCCCAAACAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl