Prev. |  KEGG KO K21764 > 

RIKEN DNA Bank Human Resource - SPAG5

Gene ID NCBI Gene 10615 |  KEGG hsa:10615
Gene Symbol SPAG5
Protein Name sperm associated antigen 5
Synonyms DEEPEST|MAP126|hMAP126
Ortholog resource in our bank

  SPAG5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080555 IRAL001G11 pOTB7 BC000322 NM_006461 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR249049 ARiS122K09 pGCAP10 NM_006461.3  
TCAGACGGCGGGTGANCNTGGCGTCCTCGACTTGGTCTGAGACGTGATAGGCCTGCCTTC
HKR348505 RBb71E09 pGCAP1 NM_006461.3  
TTTACAGACGGCGGGTGAACATGGCGTCCTCGACTTGGTCTGAGACGTGATAGGCCTGCC
HKR364976 RBd12H08 pGCAP10 NM_006461.3  
GCTGGTTGAAGATGTGGCGAGTGAAAAAACTGAGCCTCAGCCTGTCGCCTTCGCCCCAGA
HKR384084 RBd60D12 pGCAP10 NM_006461.3  
GATGGCGTCCTCGACTTGGTCTGAGACGTGATAGGCCTGCCTTCTGGTTGAAGATGTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl