Prev. | 

RIKEN DNA Bank Human Resource - ERLIN1

Gene ID NCBI Gene 10613 |  KEGG hsa:10613
Gene Symbol ERLIN1
Protein Name ER lipid raft associated 1
Synonyms C10orf69|Erlin-1|KE04|KEO4|SPFH1|SPG62
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011623 IRAK029A23 pCMV-SPORT6 BC031791 NM_006459

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR166925 ARi17F05 pGCAP10 NM_006459.3  
GGGCGGCGGTTGGCTCGGCGCGGGAGTCGGCTGCACGTGCGGGCGGGGGCGATGCGTCAC
HKR329728 RBb24F08 pGCAP1 NM_006459.3  
TGGGCGGCTGGGCTTCTTCTCAGTTAGTGCCTTCCACCCGGGTAGCGACCCTTGGGAGAG
HKR405687 RBdS014D15 pGCAP10 NM_006459.3  
GGGCTTTCCTCGCGAGCCTGCGGCTGGGCTTCTTCTCAGAGGAACGAGAATGAATATGAC
HKR441901 RBdS104M13 pGCAP10 NM_006459.3  
GACTGATCGGTGAGGCGCGGCCGAGGGGTCGGCTTTCCTCGCGAGCCTGCGGCTGGGCTT
HKR452818 RBdS132A18 pGCAP10 NM_006459.3  
TGGGGCGATGCGTCACTGATCGGTGAGGCGCGGCCGAGGGGTCGGCTTTCCTCGCGAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl