Prev. | 

RIKEN DNA Bank Human Resource - PDLIM5

Gene ID NCBI Gene 10611 |  KEGG hsa:10611
Gene Symbol PDLIM5
Protein Name PDZ and LIM domain 5
Synonyms ENH|ENH1|L9|LIM
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082054 IRAL005C06 pOTB7 BC008741 NM_006457 Full/var
HGY097139 IRAL042O03 pOTB7 BC026029 NM_001011514 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100047 M01C050B23 pDONR221 MGC14-G12 BC008741 ENST00000317968  
HGE100095 M01C050D23 pDONR221 MGC14-G12 BC008741 ENST00000317968  
HGE100143 M01C050F23 pDONR221 MGC14-G12 BC008741 ENST00000317968  
HGE100191 M01C050H23 pDONR221 MGC14-G12 BC008741 ENST00000317968  
HGE100239 M01C050J23 pDONR221 MGC14-G12 BC008741 ENST00000317968  
HGE100287 M01C050L23 pDONR221 MGC14-G12 BC008741 ENST00000317968  
HGE100335 M01C050N23 pDONR221 MGC14-G12 BC008741 ENST00000317968  
HGE100383 M01C050P23 pDONR221 MGC14-G12 BC008741 ENST00000317968  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR053751 ARe34G07 pKA1U5 NM_006457.3  
GAGTCACTTGTCAGCCCTTGTCTGAGGCGGANNCCNTTCCCGCGCCGCGCCGGACCCGAG
HKR176107 ARi40E11 pGCAP10 NM_006457.3  
CGGCCGGCCGATGGAGTCACTTGTCAGCCCTTGTCTGAGGCGGAGGCAGCCCCGCGCCGC
HKR178526 ARi46F06 pGCAP10 NM_006457.3  
GGGGGACGGCGCCCTCACCGCGAGTCACTTGTCAGCCCTTGTCTGAGGCGGAGGCAGCCC
HKR205372 ARiS013H04 pGCAP10 NM_006457.3  
TGACTTGTCAGCCCTTGTCTGAGGCGGAGGCAGCCCCGCGCCGCGCCGGACCCGAGCATA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl