Prev. |  KEGG KO K14322 > 

RIKEN DNA Bank Human Resource - PAIP1

Gene ID NCBI Gene 10605 |  KEGG hsa:10605
Gene Symbol PAIP1
Protein Name poly(A) binding protein interacting protein 1
Synonyms -
Ortholog resource in our bank

  PAIP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006354 IRAK015O18 pCMV-SPORT6 BC015937 NM_183323 Full/var
HGY086492 IRAL016D20 pDNR-LIB BC005295 NM_183323 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092025 M01C030B01 pDONR221 MGC04-G01 BC015937 NM_006451  
HGE092073 M01C030D01 pDONR221 MGC04-G01 BC015937 NM_006451  
HGE092121 M01C030F01 pDONR221 MGC04-G01 BC015937 NM_006451  
HGE092169 M01C030H01 pDONR221 MGC04-G01 BC015937 NM_006451  
HGE092217 M01C030J01 pDONR221 MGC04-G01 BC015937 NM_006451  
HGE092265 M01C030L01 pDONR221 MGC04-G01 BC015937 NM_006451  
HGE092313 M01C030N01 pDONR221 MGC04-G01 BC015937 NM_006451  
HGE092361 M01C030P01 pDONR221 MGC04-G01 BC015937 NM_006451  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR376973 RBd42H05 pGCAP10 NM_006451.4  
GGGAGATGCCCCTGCCCGAGCCTGGCTGCGGGCCGGCAGGTGGCCAAGACGCCACTCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl