Prev. |  KEGG KO K11844 > 

RIKEN DNA Bank Human Resource - USP16

Gene ID NCBI Gene 10600 |  KEGG hsa:10600
Gene Symbol USP16
Protein Name ubiquitin specific peptidase 16
Synonyms UBP-M|UBPM
Ortholog resource in our bank

  USP16

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013420 IRAK033J04 pBluescriptR BC030777 NM_006447 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR171777 ARi29H09 pGCAP10 NM_006447.2  
GACTCTGGCTTCGACTCCGTCGCTCTCAATTCGTCACCAGGAGGAAGACGGAGCTGGCTG
HKR384829 RBd62B05 pGCAP10 NM_006447.2  
GATTCGTCACCAGGAGGAAGACGGAGCTGGCTGCCCAGCCCAAAGGCCCATGAGGGGATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl