Prev. | 

RIKEN DNA Bank Human Resource - AHSA1

Gene ID NCBI Gene 10598 |  KEGG hsa:10598
Gene Symbol AHSA1
Protein Name activator of HSP90 ATPase activity 1
Synonyms AHA1|C14orf3|hAha1|p38
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080553 IRAL001G09 pOTB7 BC000321 NM_012111 Full
HGY089976 IRAL024P16 pOTB7 BC007398 NM_012111 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056877 ARe42D05 pKA1U5 NM_012111.1  
GGGCACTAAGCGGTCCTGAGGCTGTGGCTACGGCTGCTCCGGAGCTGGTGGCGCCGCGAT
HKR222019 ARiS055A19 pGCAP10 NM_012111.1  
GGGTGGAGGGAAAAGCAAGCCAGGAGGTGCTTGCGGCCGCTTCTAGTAGTTTCCAGGCGC
HKR264598 ARiS161I06 pGCAP10 NM_012111.1  
GCTAGTAGTTTCCAGGCGCTGCCGGGCGGCTGGCACTAAGCGGTCCTGAGGCTGTGGCTA
HKR328480 RBb21D08 pKA1U5 NM_012111.1  
GAGTAGTTTCCAGGCGCTGCCGGGCGGCTGGCACTAAGCGGTCCTGAGGCTGTGGCTACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl