Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AHSA1

Gene ID (NCBI) 10598
Gene Symbol AHSA1
Protein Name AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)
Synonyms AHA1|C14orf3|p38
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080553 IRAL001G09 pOTB7 BC000321 NM_012111 Full
HGY089976 IRAL024P16 pOTB7 BC007398 NM_012111 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR056877 ARe42D05 pKA1U5 NM_012111.1
GGGCACTAAGCGGTCCTGAGGCTGTGGCTACGGCTGCTCCGGAGCTGGTGGCGCCGCGAT
HKR222019 ARiS055A19 pGCAP10 NM_012111.1
GGGTGGAGGGAAAAGCAAGCCAGGAGGTGCTTGCGGCCGCTTCTAGTAGTTTCCAGGCGC
HKR264598 ARiS161I06 pGCAP10 NM_012111.1
GCTAGTAGTTTCCAGGCGCTGCCGGGCGGCTGGCACTAAGCGGTCCTGAGGCTGTGGCTA
HKR328480 RBb21D08 pKA1U5 NM_012111.1
GAGTAGTTTCCAGGCGCTGCCGGGCGGCTGGCACTAAGCGGTCCTGAGGCTGTGGCTACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl