Prev. |  KEGG KO K06674 > 

RIKEN DNA Bank Human Resource - SMC2

Gene ID NCBI Gene 10592 |  KEGG hsa:10592
Gene Symbol SMC2
Protein Name structural maintenance of chromosomes 2
Synonyms CAP-E|CAPE|SMC-2|SMC2L1
Ortholog resource in our bank

  SMC2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB18356 SMC2-mAC donor (Hygro) Donor plasmid to generate SMC2-mAID degron cell lines with mClover as a marker, hygromycin resistance.
RDB18357 SMC2 CRISPR Expression vector of Cas9 and gRNA for a SMC2 tagging donor.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX053733 IRAK134F13 pCMV-SPORT6 BC061906 NM_006444 Partial/var
HGY103074 IRAL057L10 pDNR-LIB BC071750 NM_006444 Partial/var
HGY099510 IRAL048M22 pDNR-LIB BC055081 NM_006444

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR067682 ARe69D10 pKA1U5 NM_006444.2 done
GGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGGTGTTGAGAGCGGTGTGGTAGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.07.27

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl