Prev. | 

RIKEN DNA Bank Human Resource - DNPH1

Gene ID NCBI Gene 10591 |  KEGG hsa:10591
Gene Symbol DNPH1
Protein Name 2'-deoxynucleoside 5'-phosphate N-hydrolase 1
Synonyms C6orf108|RCL|dJ330M21.3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090957 IRAL027G13 pOTB7 BC011683 NM_006443 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE045401 W01A113I09 pENTR-TOPO IRAL027G13 BC011683 NM_006443  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR078576 ARe96H08 pKA1U5 NM_006443.2  
GGGGGAATGGCTGCTGCCATGGNTGCCGGGGCGCAGCGAGAGCTGGGAGCGCGGGGAGCC
HKR079322 ARe98F02 pKA1U5 NM_006443.2  
GGCCGGAGAGCGCGGGCGGCTGGGGAATGGCTGCTGCCATGGTGCCGGGGCGCAGCGAGA
HKR243813 ARiS109I21 pGCAP10 NM_006443.2  
GGCGGCTGGGGAATGGCTGCTGCCATGGTGCCGGGGCGCAGCGAGAGCTGGGAGCGCGGG
HKR333630 RBb34B06 pGCAP1 NM_006443.2  
GGCGGCTGGGGAATGGCTGCTGCCATGGTGCCGGGGCGCAGCGAGAGCTGGGAGCGCGGG
HKR367276 RBd18D04 pGCAP10 NM_006443.2  
GAATGGCTGCTGCCATGGTGCCGGGGCGCAGCGAGAGCTGGGAGCGCGGGGAGCCTGGCC
HKR392526 RBd81F06 pGCAP10 NM_006443.2  
GAATGGCTGCTGCCATGGTGCCGGGGCGCAGCGAGAGCTGGGAGCGCGGGGAGCCTGGCC
HKR394955 RBd87G11 pGCAP10 NM_006443.2  
GGCGGGCGGCTGGGGAATGGCTGCTGCCATGGTGCCGGGGCGCAGCGAGAGCTGGGAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl