Prev. | 

RIKEN DNA Bank Human Resource - DRAP1

Gene ID NCBI Gene 10589 |  KEGG hsa:10589
Gene Symbol DRAP1
Protein Name DR1 associated protein 1
Synonyms NC2-alpha
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090823 IRAL027A23 pOTB7 BC010025 NM_006442 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE010837 W01A027B13 pENTR-TOPO IRAL027A23 BC010025 NM_006442  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR060178 ARe50H10 pKA1U5 NM_006442.2  
GAGGCCCGGGAGCCGGGAGGCTGCGGGCGGCGGCGCTGGACCCGACGCGGCGAGAGAGGC
HKR238535 ARiS096F15 pGCAP10 NM_006442.2  
GAGGGNAACCGCGACGGGCGGGCGGCGAGCAGGCCCGGGAGCCGGGAGGCTGCGGGCGGC
HKR243709 ARiS109E13 pGCAP10 NM_006442.2  
GAGGACCCNNGGGAACCGCGACGGGCGGGCGGCGAGCAGGCCCGGGAGCCGGGAGGCTGC
HKR260076 ARiS150D04 pGCAP10 NM_006442.2  
GGAGCAGGCCCGGGAGCCNGGAGGCTGCGGGCGGCGGCGCTGGACCCGACGCGGCGAGAG
HKR277955 ARiS194O19 pGCAP10 NM_006442.2  
HKR345251 RBb63C03 pGCAP1 NM_006442.2  
GGGGCGGCGAGCAGGCCCGGGAGCCGGGAGGCTGCGGGCGGCGGCGCTGGACCCGACGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl