Prev. |  KEGG KO K00728 > 

RIKEN DNA Bank Human Resource - POMT1

Gene ID NCBI Gene 10585 |  KEGG hsa:10585
Gene Symbol POMT1
Protein Name protein O-mannosyltransferase 1
Synonyms LGMD2K|LGMDR11|MDDGA1|MDDGB1|MDDGC1|RT
Ortholog resource in our bank

  POMT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013582 IRAK033P22 pBluescriptR BC022877 NM_007171 Full/var
HGX056281 IRAK140L17 pCMV-SPORT6 BC065268 NM_007171 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR374877 RBd37D05 pGCAP10 NM_007171.3  
GGCAGGCTCGGTGAATCGAACGTTGAGCAGGGCGGTGGGTGGTGCGGAGTGCCGAGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl