Prev. |  KEGG KO K06566 > 

RIKEN DNA Bank Human Resource - IFITM2

Gene ID NCBI Gene 10581 |  KEGG hsa:10581
Gene Symbol IFITM2
Protein Name interferon induced transmembrane protein 2
Synonyms 1-8D|DSPA2c
Ortholog resource in our bank

  IFITM2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005611 IRAK014A11 pCMV-SPORT6 BC009696 NM_006435 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE042801 W01A107A01 pENTR-TOPO IRAK014A11 BC009696 NM_006435  
HGE042803 W01A107A03 pENTR-TOPO IRAK014A11 BC009696 NM_006435  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR043302 ARe08E06 pKA1U5 NM_006435.2  
GACACATTGTGCAAACCTTCTCTCCTGTCAACAGCGGCCAGCCTCCCAACTACGAGATGC
HKR164028 ARi10B04 pGCAP10 NM_006435.2  
GGAGAACCATCCCGGTAACCCGATCACCGCTGGTCACCATGAACCACATTGTGCAAACCT
HKR166802 ARi17A02 pGCAP10 NM_006435.2  
GGACAAATGCCAGGAAGAGGAAACTGTTGAGAAAACGGAACTACTGGGGAAAGGGAGGGC
HKR247388 ARiS118H20 pGCAP10 NM_006435.2  
GAGACCTCCGTGCCTGACCATGTGGTCTGGTCCCTGTTCAACACCCTCTTCATGAACACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl