Prev. |  KEGG KO K09496 > 

RIKEN DNA Bank Human Resource - CCT4

Gene ID NCBI Gene 10575 |  KEGG hsa:10575
Gene Symbol CCT4
Protein Name chaperonin containing TCP1 subunit 4
Synonyms CCT-DELTA|Cctd|SRB
Ortholog resources KEGG ortholog (KEGG orthology K09496) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX004958 IRAK012G14 pCMV-SPORT6 BC014676 NM_006430 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047204 ARe18A04 pKA1U5 NM_006430.2  
GCTTCTCCGCCTCCGCCTCCTCCCGACGCCGGCGCCGCTTTCTGGAAGGTTCGTGAAGGC
HKR076532 ARe91F12 pKA1U5 NM_006430.2  
GCCCCTTCTCCGCCTCCGCCTCCTCCCGACGCCGGCGCCGCTTTCTGGAAGGTTCGTGAA
HKR178427 ARi46B03 pGCAP10 NM_006430.2  
GTTTCTGGAAGGTTCGTGAAGGCAGTGAGGGCTTACCGTTATTACACTGCGGCCGGCCAG
HKR219863 ARiS049K23 pGCAP10 NM_006430.2  
GAGTGAGGGCTTACCGTTATTACACTGCGGCCGGCCAGAATCCGGGTCCATCCGTCCTTC
HKR249002 ARiS122I10 pGCAP10 NM_006430.2  
CGGCCGGCCGATCCGGGTCCATCCGTCCTTCCCGAGCCAACCCAGACACAGCGGAGTT
HKR322403 RBb06A03 pKA1U5 NM_006430.2  
GCTTCTCCGCCTCCGCCTCCTCCCGACGCCGGCGCCGCTTTCTGGAAGGTTCGTGAAGGC
HKR332954 RBb32G10 pGCAP1 NM_006430.2  
TGCTCCCGACGCCGGCGCCGCTTTCTGGAAGGTTCGTGAAGGCAGTGAGGGCTTACCGTT
HKR370125 RBd25F05 pGCAP10 NM_006430.2  
GATTACACTGCGGCCGGCCAGAATCCGGGTCCATCCGTCCTTCCCGAGCCAACCCAGACA
HKR378124 RBd45F04 pGCAP10 NM_006430.2  
GCTCCCGACGCCGGCGCCGCTTTCTGGAAGGTTCGTGAAGGCAGTGAGGGCTTACCGTTA
HKR379660 RBd49C12 pGCAP10 NM_006430.2  
GGAAGGTTCGTGAAGGCAGTGAGGGCTTACCGTTATTACACTGCGGCCGGCCAGAATCCG
HKR470885 RBdS177D13 pGCAP10 NM_006430.2  
GCCCCTTCTCCGCCTCCGCCTCCTCCCGACGCCGGCGCCGCTTTCTGGAAGGTTCGTGAA
HKR471129 RBdS177N17 pGCAP10 NM_006430.2  
GGCTTTCTGGAAGGTTCGTGAAGGCAGTGAGGGCTTACCGTTATTACACTGCGGCCGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl