Prev. | 

RIKEN DNA Bank Human Resource - SIVA1

Gene ID NCBI Gene 10572 |  KEGG hsa:10572
Gene Symbol SIVA1
Protein Name SIVA1 apoptosis inducing factor
Synonyms CD27BP|SIVA|Siva-1|Siva-2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008507 IRAK021E11 pCMV-SPORT6 BC034562 NM_021709 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE019501 W01A048M13 pENTR-TOPO IRAK021E11 BC034562 NM_021709  
HGE019503 W01A048M15 pENTR-TOPO IRAK021E11 BC034562 NM_021709  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR323721 RBb09F01 pKA1U5 NM_006427.3  
GCCCGCGGCCATGCCCAAGCGGAGCTGCCCCTTCGTGGACGTGGCCCCGCTACAGCTCAA
HKR383308 RBd58E12 pGCAP10 NM_006427.3  
GACGGCGTCGTTGGTAAGGGGCTGGCGGCCGGGGAGCTGCGTAGCTCCCGGCCCCGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl