Prev. | 

RIKEN DNA Bank Human Resource - DPYSL4

Gene ID NCBI Gene 10570 |  KEGG hsa:10570
Gene Symbol DPYSL4
Protein Name dihydropyrimidinase like 4
Synonyms CRMP3|DRP-4|ULIP4
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR170031 ARi25B07 pGCAP10 NM_006426.2  
TTTGGCAGTCTGTCTCCCGCCGTCCCCACGCACGCGTCCCGGCTCACGCGTCCCCCCGCN
HKR171303 ARi28E07 pGCAP10 NM_006426.2  
GGCTCGCAGTCTGTCTCCCGCCGTCCCCACGCACGCGTCCCGGCTCACGCGTCCCNNN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl