Prev. |  KEGG KO K12819 > 

RIKEN DNA Bank Human Resource - SLU7

Gene ID NCBI Gene 10569 |  KEGG hsa:10569
Gene Symbol SLU7
Protein Name SLU7 homolog, splicing factor
Synonyms 9G8|hSlu7
Ortholog resource in our bank

  SLU7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04494 SEREX clone BRC-Co-64 #1 SEREX clone BRC-Co-64 #1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005459 IRAK013K19 pCMV-SPORT6 BC010634 NM_006425 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE008099 W01A020E03 pENTR-TOPO IRAK013K19 BC010634 NM_006425  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR188507 ARi71E11 pGCAP10 NM_006425.4  
GCCAGATTGGCTTGGATTCTGTGGGATGGACTTGGGGCTAGCTGCGGCGGGGCTGGAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.05.19

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl