RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - SLC19A2

Gene ID	NCBI Gene 10560 \| KEGG hsa:10560
Gene Symbol	SLC19A2
Protein Name	solute carrier family 19 member 2
Synonyms	TC1\|THMD1\|THT1\|THTR1\|TRMA

Ortholog resource in our bank

  SLC19A2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	mRNA RefSeqs/DDBJ accession⁽¹⁾
Catalog number	5'-terminal sequence⁽²⁾
HKR361660	RBd04C12	pGCAP10	NM_006996.2
HKR361660	GAGGCGTCTGTAGGGTAAAGCTGGGGGTTCTGTAGCCGGAGGCGGCGGCGAGTCCAGAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl