Prev. |  KEGG KO K13509 > 

RIKEN DNA Bank Human Resource - AGPAT1

Gene ID NCBI Gene 10554 |  KEGG hsa:10554
Gene Symbol AGPAT1
Protein Name 1-acylglycerol-3-phosphate O-acyltransferase 1
Synonyms 1-AGPAT1|G15|LPAAT-alpha|LPAATA
Ortholog resource in our bank

  AGPAT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080590 IRAL001H22 pOTB7 BC002402 NM_032741 Full
HGY083687 IRAL009D15 pOTB7 BC003007 NM_032741 Full
HGY085210 IRAL013A10 pOTB7 BC004310 NM_032741 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046125 ARe15F05 pKA1U5 NM_006411.3  
GCAGCCCTCAGAGAGACAGCAGAAAGGGAGGGAGGGAGGGTGCTGGGGGGACANCCCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl