Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARPC1A

Gene ID (NCBI) 10552
Gene Symbol ARPC1A
Protein Name actin related protein 2/3 complex, subunit 1A, 41kDa
Synonyms Arc40|HEL-68|SOP2Hs|SOP2L
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX033928 IRAK084N16 pCMV-SPORT6 BC039594 NM_006409 Full
HGX043166 IRAK107P06 pCMV-SPORT6 BC047889 NM_006409 Full
HGX047971 IRAK119P11 pCMV-SPORT6 BC054027 NM_006409 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE094819 M01C037A19 pDONR221 MGC08-A10 BC039594 NM_006409  
HGE094867 M01C037C19 pDONR221 MGC08-A10 BC039594 NM_006409  
HGE094915 M01C037E19 pDONR221 MGC08-A10 BC039594 NM_006409  
HGE094963 M01C037G19 pDONR221 MGC08-A10 BC039594 NM_006409  
HGE095011 M01C037I19 pDONR221 MGC08-A10 BC039594 NM_006409  
HGE095059 M01C037K19 pDONR221 MGC08-A10 BC039594 NM_006409  
HGE095107 M01C037M19 pDONR221 MGC08-A10 BC039594 NM_006409  
HGE095155 M01C037O19 pDONR221 MGC08-A10 BC039594 NM_006409  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042100 ARe05E04 pKA1U5 NM_006409.2  
GCGGGATCTGTCAGCCGCTCCCTCTGGGCTTCCGTCCTCCGCCCGCGCCCGACGGAGCCT
HKR057351 ARe43G07 pKA1U5 NM_006409.2  
GGTCCTCCGCCCGCGCCCGACGGAGCCTGTTCCCCTTTNANAGCCCAGAGTCCGCGAATC
HKR328497 RBb21E01 pKA1U5 NM_006409.2  
GGTTCCTCCGCCCGCGCCCGACGGAGCCTGTTTCGCGTCGACTGCCCAGAGTCCGCGAAT
HKR342426 RBb56B02 pGCAP1 NM_006409.2  
GGTCCTCCGCCCGCGCCCGAACGGAGCCTGTTCGCGTCGACTGCCCAGAGTCCGCGAATC
HKR396050 RBd90C02 pGCAP10 NM_006409.2  
TTGGACGGAGCCTGTTCGCGTCGACTGCCCAGAGTCCGCGAATCCTCCGCTCCGAGCCCG
HKR396146 RBd90G02 pGCAP10 NM_006409.2  
TTGGACGGAGCCTGTTCGCGTCGACTGCCCAGAGTCCGCGAATCCTCCGCTCCGAGCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl