Prev. |  KEGG KO K20393 > 

RIKEN DNA Bank Human Resource - ARL6IP5

Gene ID NCBI Gene 10550 |  KEGG hsa:10550
Gene Symbol ARL6IP5
Protein Name ADP ribosylation factor like GTPase 6 interacting protein 5
Synonyms DERP11|GTRAP3-18|HSPC127|JWA|PRAF3|Yip6b|addicsin|hp22|jmx
Ortholog resource in our bank

  ARL6IP5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04596 SEREX clone NGO-Br-25 (ID 832) #1 SEREX clone NGO-Br-25 (ID 832) #1

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083184 IRAL007P24 pOTB7 BC005143 NM_006407 Full
HGY094010 IRAL035A10 pDNR-LIB BC020797 NM_006407 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR060507 ARe51E11 pKA1U5 NM_006407.3  
AAAAGCTGAGAACATGGACGTTAATATCGCCCCACTCCGCGCCTGGGACGATTTCTTCCC
HKR163700 ARi09E04 pGCAP10 NM_006407.3  
GAAAAGCCGACCGAGACGGAGCCGCTGTCAACTCTCCAACTCAGCTCAGCTGATCGGTTG
HKR205483 ARiS013L19 pGCAP10 NM_006407.3  
GGCAAAGCTGAGAACATGGACGTTAATATCGCCCCACTCCGCGCCTGGGACGATTTCTTC
HKR218006 ARiS045A06 pGCAP10 NM_006407.3  
NGGAGAACATGGACNTTNNTATCNCCCCACTCCGCGCCTGGNACGATTTCTTCCCGGGTT
HKR248922 ARiS122F02 pGCAP10 NM_006407.3  
GGTCTGCCAACCGCAAAGCCGACCGAGACGGAGCCGCTGTCAACTCTCCAACTCAGCTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.19

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl