Prev. |  KEGG KO K03386 > 

RIKEN DNA Bank Human Resource - PRDX4

Gene ID NCBI Gene 10549 |  KEGG hsa:10549
Gene Symbol PRDX4
Protein Name peroxiredoxin 4
Synonyms AOE37-2|AOE372|HEL-S-97n|PRX-4
Ortholog resource in our bank

  PRDX4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083114 IRAL007N02 pOTB7 BC003609 NM_006406 Full
HGY088718 IRAL021N06 pDNR-LIB BC007107 NM_006406 Full
HGY093088 IRAL032L24 pDNR-LIB BC016770 NM_006406 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097245 M01C043B21 pDONR221 MGC11-C11 BC003609 NM_006406  
HGE097293 M01C043D21 pDONR221 MGC11-C11 BC003609 NM_006406  
HGE097341 M01C043F21 pDONR221 MGC11-C11 BC003609 NM_006406  
HGE097389 M01C043H21 pDONR221 MGC11-C11 BC003609 NM_006406  
HGE097437 M01C043J21 pDONR221 MGC11-C11 BC003609 NM_006406  
HGE097485 M01C043L21 pDONR221 MGC11-C11 BC003609 NM_006406  
HGE097533 M01C043N21 pDONR221 MGC11-C11 BC003609 NM_006406  
HGE097581 M01C043P21 pDONR221 MGC11-C11 BC003609 NM_006406  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052926 ARe32F06 pKA1U5 NM_006406.1  
GGCGGTTGTAGCTGCCCGGCGGCGGCAGAAGCGGCGCTCGCGCCAAGGGACGTGTTTCTG
HKR163707 ARi09E11 pGCAP10 NM_006406.1  
GGTAGCTGCCCGGCGGCGGCAGAAGCGGCGCTCGCGCCAAGGGACGTGTTTCTGCGCTCG
HKR179722 ARi49F02 pGCAP10 NM_006406.1  
GAGAAGCGGCGCTCGCGCCAAGGGACGTGTTTCTGCGCTCGCGTGGTCATGGAGGCGCTG
HKR203419 ARiS008J03 pGCAP10 NM_006406.1  
GGGCGGCAGAAGCGGCGCTCGCGCCAAGGGACGTGTTTCTGCGCTCGCGTGGTCATGGAG
HKR203476 ARiS008L12 pGCAP10 NM_006406.1  
GGTCGTGCACGCGGTTGTAGCTGCCCGGCGGCGGCAGAAGCGGCGCTCGCGCCAAGGGAC
HKR205578 ARiS013P18 pGCAP10 NM_006406.1  
GGGCAGAAGCGGCGCTCGCGCCAAGGGACGTGTTTCTGCGCTCGCGTGGTCATGGAGGCG
HKR331330 RBb28F10 pGCAP1 NM_006406.1  
GTGAGAAGCGGCGCTCGCGCCAAGGGACGTGTTTCTGCGCTCGCGTGGTCATGGAGGCGC
HKR372577 RBd31H09 pGCAP10 NM_006406.1  
GAGAAGCGGCGCTCGCGCCAAGGGACGTGTTTCTGCGCTCGCGTGGTCATGGAGGCGCTG
HKR372905 RBd32E09 pGCAP10 NM_006406.1  
GGCTCGCGTGGTCATGGAGGCGCTGCCGCTGCTAGCCGCGACAACTCCGGACCACGGCCG
HKR380175 RBd50H07 pGCAP10 NM_006406.1  
GAGAAGCGGCGCTCGCGCCAAGGGACGTGTTTCTGCGCTCGCGTGGTCATGGAGGCGCTG
HKR461708 RBdS154E12 pGCAP10 NM_006406.1  
GAGAAGCGGCGCTCGCGCCAAGGGACGTGTTTCTGCGCTCGCGTGGTCATGGAGGCGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl