Prev. |  KEGG KO K03386 > 

RIKEN DNA Bank Human Resource - PRDX4

Gene ID NCBI Gene 10549 |  KEGG hsa:10549
Gene Symbol PRDX4
Protein Name peroxiredoxin 4
Synonyms AOE37-2|AOE372|HEL-S-97n|PRX-4
Ortholog resources KEGG ortholog (KEGG orthology K03386) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083114 IRAL007N02 pOTB7 BC003609 NM_006406 Full
HGY088718 IRAL021N06 pDNR-LIB BC007107 NM_006406 Full
HGY093088 IRAL032L24 pDNR-LIB BC016770 NM_006406 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097245 M01C043B21 pDONR221 MGC11-C11 BC003609 NM_006406  
HGE097293 M01C043D21 pDONR221 MGC11-C11 BC003609 NM_006406  
HGE097341 M01C043F21 pDONR221 MGC11-C11 BC003609 NM_006406  
HGE097389 M01C043H21 pDONR221 MGC11-C11 BC003609 NM_006406  
HGE097437 M01C043J21 pDONR221 MGC11-C11 BC003609 NM_006406  
HGE097485 M01C043L21 pDONR221 MGC11-C11 BC003609 NM_006406  
HGE097533 M01C043N21 pDONR221 MGC11-C11 BC003609 NM_006406  
HGE097581 M01C043P21 pDONR221 MGC11-C11 BC003609 NM_006406  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052926 ARe32F06 pKA1U5 NM_006406.1  
GGCGGTTGTAGCTGCCCGGCGGCGGCAGAAGCGGCGCTCGCGCCAAGGGACGTGTTTCTG
HKR163707 ARi09E11 pGCAP10 NM_006406.1  
GGTAGCTGCCCGGCGGCGGCAGAAGCGGCGCTCGCGCCAAGGGACGTGTTTCTGCGCTCG
HKR179722 ARi49F02 pGCAP10 NM_006406.1  
GAGAAGCGGCGCTCGCGCCAAGGGACGTGTTTCTGCGCTCGCGTGGTCATGGAGGCGCTG
HKR203419 ARiS008J03 pGCAP10 NM_006406.1  
GGGCGGCAGAAGCGGCGCTCGCGCCAAGGGACGTGTTTCTGCGCTCGCGTGGTCATGGAG
HKR203476 ARiS008L12 pGCAP10 NM_006406.1  
GGTCGTGCACGCGGTTGTAGCTGCCCGGCGGCGGCAGAAGCGGCGCTCGCGCCAAGGGAC
HKR205578 ARiS013P18 pGCAP10 NM_006406.1  
GGGCAGAAGCGGCGCTCGCGCCAAGGGACGTGTTTCTGCGCTCGCGTGGTCATGGAGGCG
HKR331330 RBb28F10 pGCAP1 NM_006406.1  
GTGAGAAGCGGCGCTCGCGCCAAGGGACGTGTTTCTGCGCTCGCGTGGTCATGGAGGCGC
HKR372577 RBd31H09 pGCAP10 NM_006406.1  
GAGAAGCGGCGCTCGCGCCAAGGGACGTGTTTCTGCGCTCGCGTGGTCATGGAGGCGCTG
HKR372905 RBd32E09 pGCAP10 NM_006406.1  
GGCTCGCGTGGTCATGGAGGCGCTGCCGCTGCTAGCCGCGACAACTCCGGACCACGGCCG
HKR380175 RBd50H07 pGCAP10 NM_006406.1  
GAGAAGCGGCGCTCGCGCCAAGGGACGTGTTTCTGCGCTCGCGTGGTCATGGAGGCGCTG
HKR461708 RBdS154E12 pGCAP10 NM_006406.1  
GAGAAGCGGCGCTCGCGCCAAGGGACGTGTTTCTGCGCTCGCGTGGTCATGGAGGCGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl