DNA Bank Top | 

RIKEN DNA Bank Human Resource - GLRX3

Gene ID NCBI Gene 10539 |  KEGG hsa:10539
Gene Symbol GLRX3
Protein Name glutaredoxin 3
Synonyms GLRX4|GRX3|GRX4|PICOT|TXNL2|TXNL3

Link

Ortholog resource in our bank


External database

human GLRX3

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB04573 SEREX clone NGO-Br-58 (ID 1295) #1 SEREX clone NGO-Br-58 (ID 1295) #1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086463 IRAL016C15 pDNR-LIB BC005289 NM_006541 Full/var
HGY092631 IRAL031J15 pDNR-LIB BC014372 NM_006541 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR326505 RBb16E09 pKA1U5 NM_006541.3  
GTGGCGGCGGCAGCATGGCGGCGGGGGCGGCTGAGGCAGCTGTAGCGGCCGTGGAGGAGG
HKR461779 RBdS154H11 pGCAP10 NM_006541.3  
GCTGGCGGCGGCAGCATGGCGGCGGGGGCGGCTGAGGCAGCTGTAGCGGCCGTGGAGGAG
HKR461922 RBdS154N10 pGCAP10 NM_006541.3  
GGCTTCTGTCTGGCGGCGGCAGCATGGCGGCGGGGGCGGCTGAGGCAGCTGTAGCGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl