Prev. |  KEGG KO K22460 > 

RIKEN DNA Bank Human Resource - P3H3

Gene ID NCBI Gene 10536 |  KEGG hsa:10536
Gene Symbol P3H3
Protein Name prolyl 3-hydroxylase 3
Synonyms GRCB|HSU47926|LEPREL2
Ortholog resources KEGG ortholog (KEGG orthology K22460) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056633 IRAK141J17 pCMV-SPORT6 BC067251 NM_014262 Partial/var
HGY087100 IRAL017M12 pOTB7 BC017217 NM_014262 Partial
HGY103864 IRAL059K24 pOTB7 BC080630 NM_014262 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR433266 RBdS083C18 pGCAP10 NM_014262.3  
TGACTCAGCACTCTTCTCTCTCCATCTTTTCACATGGGCCTCTCCCACCATCGGGTCTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl