Prev. | 

RIKEN DNA Bank Human Resource - ZNRD2

Gene ID NCBI Gene 10534 |  KEGG hsa:10534
Gene Symbol ZNRD2
Protein Name zinc ribbon domain containing 2
Synonyms SSSCA1|p27
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008417 IRAK021A17 pCMV-SPORT6 BC014791 NM_006396 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092411 M01C031A11 pDONR221 MGC05-A06 BC014791 ENST00000309328  
HGE092459 M01C031C11 pDONR221 MGC05-A06 BC014791 ENST00000309328  
HGE092507 M01C031E11 pDONR221 MGC05-A06 BC014791 ENST00000309328  
HGE092555 M01C031G11 pDONR221 MGC05-A06 BC014791 ENST00000309328  
HGE092603 M01C031I11 pDONR221 MGC05-A06 BC014791 ENST00000309328  
HGE092651 M01C031K11 pDONR221 MGC05-A06 BC014791 ENST00000309328  
HGE092699 M01C031M11 pDONR221 MGC05-A06 BC014791 ENST00000309328  
HGE092747 M01C031O11 pDONR221 MGC05-A06 BC014791 ENST00000309328  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR326458 RBb16C10 pKA1U5 NM_006396.1  
GGGTGACAACGGCAACATGGCCCTGAACGGAGCTGAAGTCGACGACTTCTCCTGGGAGCC
HKR366451 RBd16C03 pGCAP10 NM_006396.1  
GGGTGACAACGGCAACATGGCCCTGAACGGAGCTGAAGTCGACGACTTCTCCTGGGAGCC
HKR367775 RBd19H07 pGCAP10 NM_006396.1  
GGGTGACAACGGCAACATGGCCCTGAACGGAGCTGAAGTCGACGACTTCTCCTGGGAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl