Prev. |  KEGG KO K09486 > 

RIKEN DNA Bank Human Resource - HYOU1

Gene ID NCBI Gene 10525 |  KEGG hsa:10525
Gene Symbol HYOU1
Protein Name hypoxia up-regulated 1
Synonyms GRP-170|Grp170|HSP12A|ORP-150|ORP150
Ortholog resources KEGG ortholog (KEGG orthology K09486) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04435 SEREX clone BRC-Co-52 #1 SEREX clone BRC-Co-52 #1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX069670 IRAK174C22 pCMV-SPORT6 BC072436 NM_006389 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE024310 W01A060M22 pENTR-TOPO flj0074b02 AK127324 NM_006389  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056434 ARe41B10 pKA1U5 NM_006389.3  
GGCTAATGTAACAGTTTGCAAACCGAGAGGAGTTGTGAAGGGCGCGGGTGGGGGGCGCTG
HKR260208 ARiS150I16 pGCAP10 NM_006389.3  
AGGTTGGTGGCTAATGTNNCAGTTTGCAAACCGAGAGGAGTTGTGAAGGGCGCGGGTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl