Prev. |  KEGG KO K11304 > 

RIKEN DNA Bank Human Resource - KAT5

Gene ID NCBI Gene 10524 |  KEGG hsa:10524
Gene Symbol KAT5
Protein Name lysine acetyltransferase 5
Synonyms ESA1|HTATIP|HTATIP1|PLIP|TIP|TIP60|ZC2HC5|cPLA2
Ortholog resource in our bank

  KAT5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056147 IRAK140G03 pCMV-SPORT6 BC064912 NM_006388 Full
HGX001557 IRAK003O21 pCMV-SPORT6 BC000166 NM_182709 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE002236 W01A005J20 pENTR-TOPO IRAK140G03 BC064912 NM_006388  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR078451 ARe96C03 pKA1U5 NM_006388  
GGGAGAGACCTAAGTGCTGGAGCTTAGGGATCCGGCCTGGGGGTGGAGTTCAGGTCGTGG
HKR374901 RBd37E05 pGCAP10 NM_006388  
GGGAGGGAGGGAAGATGGCGGAGGTGGGGGAGATAATCGAGGGCTGCCGCCTACCCGTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl