Prev. |  KEGG KO K12841 > 

RIKEN DNA Bank Human Resource - CHERP

Gene ID NCBI Gene 10523 |  KEGG hsa:10523
Gene Symbol CHERP
Protein Name calcium homeostasis endoplasmic reticulum protein
Synonyms DAN16|SCAF6|SRA1
Ortholog resource in our bank

  CHERP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY095626 IRAL039B02 pOTB7 BC021294 NM_006387 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100802 M01C052A02 pDONR221 MGC15-F01 BC021294 NM_145046  
HGE100850 M01C052C02 pDONR221 MGC15-F01 BC021294 NM_145046  
HGE100898 M01C052E02 pDONR221 MGC15-F01 BC021294 NM_145046  
HGE100946 M01C052G02 pDONR221 MGC15-F01 BC021294 NM_145046  
HGE100994 M01C052I02 pDONR221 MGC15-F01 BC021294 NM_145046  
HGE101042 M01C052K02 pDONR221 MGC15-F01 BC021294 NM_145046  
HGE101090 M01C052M02 pDONR221 MGC15-F01 BC021294 NM_145046  
HGE101138 M01C052O02 pDONR221 MGC15-F01 BC021294 NM_145046  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR243788 ARiS109H20 pGCAP10 NM_006387.5  
GGGNGGTGGNCGATCNCGTGGNGCCGGAGGANGTTCCCCGAGGCCGGANCCNTGGAGATG
HKR344503 RBb61E07 pGCAP1 NM_006387.5  
GGCGCTGGTGGTCGATCGTGTGGCGCCGGAGGACGTTCCCCGCGGCCGGAGCCATGGAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl