Prev. |  KEGG KO K13178 > 

RIKEN DNA Bank Human Resource - DDX17

Gene ID NCBI Gene 10521 |  KEGG hsa:10521
Gene Symbol DDX17
Protein Name DEAD-box helicase 17
Synonyms P72|RH70
Ortholog resource in our bank

  DDX17

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY025273 IRAK063D01 pBluescriptR BC029553 NM_030881 Partial/var
HGY036351 IRAK090O15 pBluescript BC045747 NM_030881 Partial/var
HGY082050 IRAL005C02 pOTB7 BC000595 NM_030881 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR420585 RBdS051H17 pGCAP10 NM_001098504.1  
GGAGCCCTCGGGCTATTCCGAGGCGCTGTTTACGTATCGTCTCCGCCGTACGCAGCGTTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl