Prev. |  KEGG KO K17259 > 

RIKEN DNA Bank Human Resource - CIB1

Gene ID NCBI Gene 10519 |  KEGG hsa:10519
Gene Symbol CIB1
Protein Name calcium and integrin binding 1
Synonyms CIB|CIBP|KIP1|PRKDCIP|SIP2-28
Ortholog resources KEGG ortholog (KEGG orthology K17259) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001892 IRAK004M04 pCMV-SPORT6 BC000846 NM_006384 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE091620 M01C029A20 pDONR221 MGC04-B10 BC000846 ENST00000328649  
HGE091668 M01C029C20 pDONR221 MGC04-B10 BC000846 ENST00000328649  
HGE091716 M01C029E20 pDONR221 MGC04-B10 BC000846 ENST00000328649  
HGE091764 M01C029G20 pDONR221 MGC04-B10 BC000846 ENST00000328649  
HGE091812 M01C029I20 pDONR221 MGC04-B10 BC000846 ENST00000328649  
HGE091860 M01C029K20 pDONR221 MGC04-B10 BC000846 ENST00000328649  
HGE091908 M01C029M20 pDONR221 MGC04-B10 BC000846 ENST00000328649  
HGE091956 M01C029O20 pDONR221 MGC04-B10 BC000846 ENST00000328649  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR164083 ARi10D11 pGCAP10 NM_006384.3  
GGTCTCGAGGCGAGTTGGCGGAGCTGTGCGCGCGGCGGGGCGATGGGGGGCTCGGGCAGT
HKR184033 ARi60B09 pGCAP10 NM_006384.3  
GAGCGAGATAGTTGTCTGGGTCTCGAGGCCAGTTGGNGGAGATGTGCTTCCGGCGAGGGG
HKR249075 ARiS122L11 pGCAP10 NM_006384.3  
AGAAAGTTGTCTGCGTCTCGAGGCGAGTTGGCGGAGCTGTGCGCGCGGCGGGGCGATGGG
HKR344923 RBb62F03 pGCAP1 NM_006384.3  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl