Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - SEMA4B

Gene ID (NCBI) 10509
Gene Symbol SEMA4B
Protein Name semaphorin 4B
Synonyms SEMAC|SemC
Databases KEGG hsa:10509 |  NCBI Gene 10509
Featured content Axon guidance - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06521)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005271 IRAK013C23 pCMV-SPORT6 BC010701 NM_198925 Partial/var
HGX009003 IRAK022I11 pCMV-SPORT6 BC017658 NM_198925 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046546 ARe16G02 pKA1U5 NM_020210.3  
ATCCTGGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTA
HKR047730 ARe19F10 pKA1U5 NM_020210.3  
GGCGGGTGAGCTCTGCCCAAGCCGAGGCTGCGGGGCCGGCGCCGGCGGGAGGACTGCGGT
HKR405463 RBdS013K23 pGCAP10 NM_020210.3  
GAGACTaagTGCTGAgCttGTAgTGAATGCCCAGCCATGACTTGCAGTGGATTGACCTGT
HKR442249 RBdS105K09 pGCAP10 NM_020210.3  
GACCGTCGCTCCTGCTCTCCGAATGCTGCGCACCGCGATGGGCCTGAGGAGCTGGCTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.02.22

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl