Prev. |  KEGG KO K06521 > 

RIKEN DNA Bank Human Resource - SEMA4B

Gene ID NCBI Gene 10509 |  KEGG hsa:10509
Gene Symbol SEMA4B
Protein Name semaphorin 4B
Synonyms SEMAC|SemC
Featured content Axon guidance - human
Ortholog resource in our bank

  SEMA4B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005271 IRAK013C23 pCMV-SPORT6 BC010701 NM_198925 Partial/var
HGX009003 IRAK022I11 pCMV-SPORT6 BC017658 NM_198925 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046546 ARe16G02 pKA1U5 NM_020210.3  
ATCCTGGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTA
HKR047730 ARe19F10 pKA1U5 NM_020210.3  
GGCGGGTGAGCTCTGCCCAAGCCGAGGCTGCGGGGCCGGCGCCGGCGGGAGGACTGCGGT
HKR405463 RBdS013K23 pGCAP10 NM_020210.3  
GAGACTaagTGCTGAgCttGTAgTGAATGCCCAGCCATGACTTGCAGTGGATTGACCTGT
HKR442249 RBdS105K09 pGCAP10 NM_020210.3  
GACCGTCGCTCCTGCTCTCCGAATGCTGCGCACCGCGATGGGCCTGAGGAGCTGGCTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl